Nature of Water | Get the Essay

BIO 115 ONLINE BLOCK 4 TAKE-HOME TEST   Water   1.?Describe the polar nature of water.  Describe the structural features of the ?molecule that make it polar.       2.?What is hydrogen bonding in water?  How does this relate to surface tension ?that exists in a glass of water?         3.?Why did the first organisms that appeared on earth need to remain underwater? ?Why couldn’t they live on land?       4.?Describe:   ?-the process of biochemical synthesis     ??-why is it sometimes called dehydration?     ?-the process of biochemical hydrolysis       Introduction to biomolecules   5.?What are the 4 major categories of biomolecules found in living systems?       Proteins   6.?Proteins are made of ___________________ strung together   7.?Draw a generic amino acid   8.?How are different amino acids structurally different from one another?       9.?Proteins have 4 levels of structural organization.  What are they?       10.?Amino acids in a protein are connected together by _______________ bonds   11.?What level of protein organization is represented below? ?     12.?What are the 2 most common secondary structures found in proteins?     ?-draw each below         13.?Draw a protein that has secondary structures within it and a tertiary structure. ?Label the secondary structure(s) and indicate the tertiary structure.             14.?Draw a protein with quaternary structure.           15.?What happens when a protein is denatured and what things can denature it?       16.?Do all amino acids possess the same number of carbons?   17.?Many proteins are enzymes.  What do enzymes do in biochemical systems?       18.?What is an enzyme’s active site?  What happens there?         19.?What nonprotein molecules often work with enzymes and from where are they ?derived?       CARBOHYDRATES   20.?All (or at least most) carbohydrate names have what suffix?  It is:   21.?What is the derivation of the term carbohydrate?  What are the name’s ?component parts?       22.?Carbohydrates have a category/group called the monosaccharides.     ?-draw a monosaccharide below           ?-why are they called monosaccharides?     23.?Draw a monosaccharide in its haworth projection below           24.?Name ________________ monosaccharides   ?-2 significant pentose???-2 significant hexose   25.?Monosaccharides are linked together to form a disaccharide.  How is this linkage ?formed?           26.?Draw an alpha disaccharide linkage bond and a beta disaccharide linkage bond.             ?-what is the biological significance of these 2 linkages?       27.?Name 3 significant disaccharides   28.?What population of humans worldwide is the most lactose tolerant?   29.?What causes lactose intolerance?     30.?What is the difference between a monosaccharide, a disaccharide, and a ? polysaccharide?     31.?How are starch, cellulose and glycogen similar?     ?-how are they different?     ?-what is the function of each?   ??-starch??-cellulose??-glycogen     32.?If mammals cannot break beta polysaccharide linkages, how is it possible for ?them to obtain calories from the cellulose that they eat??       33.?Where do you find chitin in nature?   ?-is it a mono-, di-, or polysaccharide?   LIPIDS   34.?Draw a saturated fatty acid with 12 carbon atoms here       35.?What is the difference between a saturated and unsaturated fatty acid       ?-draw an unsaturated fatty acid below       36.?Draw a cis-unsaturated fatty acid and a trans-unsaturated fatty acid below.  Make ?a note of the structural differences between the two.             37.?Draw a triacylglyceride below and label it’s component parts               38.?What is the difference between a fat and an oil?  What do they have in common?         39.?Draw a picture of a phospholipid.  Label the hydrophobic and the hydrophilic ?portions       40.?Phospholipids are a common component of the cell _______________________   41.?The other class of lipids is the steroids.  Why do you think they are classified as ?lipids?     42.?What are examples of steroid-like lipids presented in class?       DNA – General   43.?Nucleic acids are made of long strings of nucleotides.  Draw a nucleotide and ?label its 3 components.         44.?What are the 4 nucleotides found in:   ?-DNA  –   ?-RNA  –   45.?What are 3 differences between DNA molecules and RNA molecules?       46.?This is a 1/2 of a strand of DNA:   ?AATCTGCGTCTGTCAGTTCGT   ?What is the 2nd. complementary strand?     47.?The nucleotide strands in the DNA molecule are antiparallel.  What does this ?mean?       48.?Why do they call DNA a double helix?       49.?Draw the new and improved, updated Central Dogma Theory of DNA and RNA ?function and interactions below–               DNA – Part 2   50.?What is transcription and where does it occur in a cell?     51.?The following 1/2 strand of DNA needs to be transcribed.  It will be used to make ?a protein.   ?AATCTGCGTCTGTCAGTTCGT   ?-what is the resultant mRNA molecule that will be produced?   ?-how many codons does the mRNA strand contain?   52.?After transcription in the nucleus, the mRNA travels to the cytoplasm to be used ?to make a protein by translation.  The following nucleic acid structures participate ?in translation-what are their names and their functions?   ?-tRNA  –   ?-rRNA  –   ?mRNA  –   53.?What is the composition and structure of a ribosome and what role does it play in ?translation?                   54.?The following is a double strand of DNA to be used to make a protein:     ?ATGATTCGCTCAATCGGA – sense strand ?TACTAAGCGAGTTAGCCT   ?-the sense strand will be transcribed   ?-here is the sense strand sequence divided into codons:   ?ATG   ATT   CGC   TCA   ATC   GGA   ?____  ____  ____   ____  ____   _____  -write the corresponds sequence in the mRNA     ?____  ____  ____   ____  ____   _____  -write the matching anticodon sequences of tRNA     ?-how many amino acids will be connected to make the corresponding protein?     55.?Briefly describe the step by step process of translation   ?                                             The cell membrane   56.?Illustrate the Fluid Mosaic Model of the typical cell membrane and label ?its components             57.?Why do they call it:   ?-fluid   ?-mosaic   58.?Define osmosis     59.?Define the process of:   ?-diffusion across a membrane     ?-facilitated transport across a cell membrane     ?-active transport across a cell membrane   60.?Define:   ?-exocytosis     ?-endocytosis   Cell structure and organelles   61.?What is the difference between a prokaryotic and a eukaryotic cell?     62.?What is apoptosis?  Under what conditions does it occur?

So much stress and so little time? Take care of yourself: let us help you with your task on
Nature of Water | Get the Essay
Celebrate our anniversary with us. Get the Solution at $10/page
Get Help

What Will You Get?

We provide professional writing services to help you score straight A’s by submitting custom written assignments that mirror your guidelines.

Premium Quality

Get result-oriented writing and never worry about grades anymore. We follow the highest quality standards to make sure that you get perfect assignments.

Experienced Writers

Our writers have experience in dealing with papers of every educational level. You can surely rely on the expertise of our qualified professionals.

On-Time Delivery

Your deadline is our threshold for success and we take it very seriously. We make sure you receive your papers before your predefined time.

24/7 Customer Support

Someone from our customer support team is always here to respond to your questions. So, hit us up if you have got any ambiguity or concern.

Complete Confidentiality

Sit back and relax while we help you out with writing your papers. We have an ultimate policy for keeping your personal and order-related details a secret.

Authentic Sources

We assure you that your document will be thoroughly checked for plagiarism and grammatical errors as we use highly authentic and licit sources.

Moneyback Guarantee

Still reluctant about placing an order? Our 100% Moneyback Guarantee backs you up on rare occasions where you aren’t satisfied with the writing.

Order Tracking

You don’t have to wait for an update for hours; you can track the progress of your order any time you want. We share the status after each step.

image

Areas of Expertise

Although you can leverage our expertise for any writing task, we have a knack for creating flawless papers for the following document types.

Areas of Expertise

Although you can leverage our expertise for any writing task, we have a knack for creating flawless papers for the following document types.

image

Trusted Partner of 9650+ Students for Writing

From brainstorming your paper's outline to perfecting its grammar, we perform every step carefully to make your paper worthy of A grade.

Preferred Writer

Hire your preferred writer anytime. Simply specify if you want your preferred expert to write your paper and we’ll make that happen.

Grammar Check Report

Get an elaborate and authentic grammar check report with your work to have the grammar goodness sealed in your document.

One Page Summary

You can purchase this feature if you want our writers to sum up your paper in the form of a concise and well-articulated summary.

Plagiarism Report

You don’t have to worry about plagiarism anymore. Get a plagiarism report to certify the uniqueness of your work.

Free Features $66FREE

  • Most Qualified Writer $10FREE
  • Plagiarism Scan Report $10FREE
  • Unlimited Revisions $08FREE
  • Paper Formatting $05FREE
  • Cover Page $05FREE
  • Referencing & Bibliography $10FREE
  • Dedicated User Area $08FREE
  • 24/7 Order Tracking $05FREE
  • Periodic Email Alerts $05FREE
image

Our Services

Join us for the best experience while seeking writing assistance in your college life. A good grade is all you need to boost up your academic excellence and we are all about it.

  • On-time Delivery
  • 24/7 Order Tracking
  • Access to Authentic Sources
Academic Writing

We create perfect papers according to the guidelines.

Professional Editing

We seamlessly edit out errors from your papers.

Thorough Proofreading

We thoroughly read your final draft to identify errors.

image

Delegate Your Challenging Writing Tasks to Experienced Professionals

Work with ultimate peace of mind because we ensure that your academic work is our responsibility and your grades are a top concern for us!

Check Out Our Sample Work

Dedication. Quality. Commitment. Punctuality

Categories
All samples
Literature Analysis/Review
Discussion Essay
Coursework
Essay (any type)
Literature Analysis/Review
Metamorphosis by Kafka
Undergrad. (yrs 3-4)
Classic English Literature
4
View this sample
Discussion Essay
Discussion Post
Master's
Nursing
1
View this sample
Discussion Essay
A Vote for Majijauna Legalization
Undergrad. (yrs 3-4)
Nursing
3
View this sample
Discussion Essay
Beyind Bias in Testing
Master's
Psychology
3
View this sample
Coursework
Logic Model-Petrakis Family
Master's
Social Work and Human Services
3
View this sample
Essay (any type)
Antigone by Sophocles
Undergrad. (yrs 3-4)
Classic English Literature
4
View this sample

It May Not Be Much, but It’s Honest Work!

Here is what we have achieved so far. These numbers are evidence that we go the extra mile to make your college journey successful.

0+

Happy Clients

0+

Words Written This Week

0+

Ongoing Orders

0%

Customer Satisfaction Rate
image

Process as Fine as Brewed Coffee

We have the most intuitive and minimalistic process so that you can easily place an order. Just follow a few steps to unlock success.

See How We Helped 9000+ Students Achieve Success

image

We Analyze Your Problem and Offer Customized Writing

We understand your guidelines first before delivering any writing service. You can discuss your writing needs and we will have them evaluated by our dedicated team.

  • Clear elicitation of your requirements.
  • Customized writing as per your needs.

We Mirror Your Guidelines to Deliver Quality Services

We write your papers in a standardized way. We complete your work in such a way that it turns out to be a perfect description of your guidelines.

  • Proactive analysis of your writing.
  • Active communication to understand requirements.
image
image

We Handle Your Writing Tasks to Ensure Excellent Grades

We promise you excellent grades and academic excellence that you always longed for. Our writers stay in touch with you via email.

  • Thorough research and analysis for every order.
  • Deliverance of reliable writing service to improve your grades.
Place an Order Start Chat Now
image